Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province

  • Putri Pandarangga(1*)
    Laboratory of Clinic, Reproduction, Pathology and Nutrition, Faculty of Medicine and Veterinary Medicine, Nusa Cendana University, Kupang
  • Abigail E. Ticoalu(2)
    Faculty of Medicine and Veterinary Medicine, Nusa Cendana University, Kupang
  • Maria A. E. G. A Gelolodo(3)
    Laboratory of Animal Diseases and Veterinary Public Health, Faculty of Medicine and Veterinary Medicine, Nusa Cendana University, Kupang
  • Larry R. W. Toha(4)
    Laboratory of Animal Diseases and Veterinary Public Health, Faculty of Medicine and Veterinary Medicine, Nusa Cendana University, Kupang
    • (*) Corresponding Author
DOI: https://doi.org/10.35508/jkv.v11i2.13118
Keywords: African Swine Fever, Kupang, PCR, Primer

Abstract

African Swine Fever (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan false negatives pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : 5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer) dan 5' GCCGATACCACAAGATCAGC 3' (reverse primer) dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.

Downloads

Download data is not yet available.

References

Aguero, M., Fernández, J., Romero, L., Sánchez Mascaraque, C., Arias, M., & Sánchez-Vizcaíno, J. M. (2003). Highly sensitive PCR assay for routine diagnosis of African swine fever virus in clinical samples. Journal of Clinical Microbiology, 41(9), 4431–4434.
Alejo, A., Matamoros, T., Guerra, M., & Andrés, G. (2018). A proteomic atlas of the African swine fever virus particle. Journal of Virology, 92(23), e01293-18.
Blome, S., Franzke, K., & Beer, M. (2020). African swine fever–A review of current knowledge. Virus Research, 287, 198099.
Dixon, L. K., Chapman, D. A. G., Netherton, C. L., & Upton, C. (2013). African swine fever virus replication and genomics. Virus Research, 173(1), 3–14.
Doan, P. T., Cahyono, M. I., Rabiei, M., Pandarangga, P., McAllister, M. M., & Low, W. Y. (n.d.). Genome sequences of Newcastle disease virus strains from two outbreaks in Indonesia. Microbiol Resour Announc. 2020; 9 (23): e00205-20. PUBMED.
Franzoni, G., Pedrera, M., & Sánchez-Cordón, P. J. (2023). African swine fever virus infection and cytokine response in vivo: an update. Viruses, 15(1), 233.
Gonzague, M., Plin, C., Bakkali-Kassimi, L., Boutrouille, A., & Cruciere, C. (2002). Development of an internal control for the detection of the African swine fever virus by PCR. Molecular and Cellular Probes, 16(3), 237–242.
Izzati, U. Z., Inanaga, M., Hoa, N. T., Nueangphuet, P., Myint, O., Truong, Q. L., Lan, N. T., Norimine, J., Hirai, T., & Yamaguchi, R. (2021). Pathological investigation and viral antigen distribution of emerging African swine fever in Vietnam. Transboundary and Emerging Diseases, 68(4), 2039–2050.
Jahang, B. (2023, February 8). 500.000 ekor ternak babi di NTT mati akibat virus ASF.
Leslie, E. E. C., Geong, M., Abdurrahman, M., Ward, M. P., & Toribio, J.-A. L. M. L. (2015). A description of smallholder pig production systems in eastern Indonesia. Preventive Veterinary Medicine, 118(4), 319–327.
OIE. (2021). AFRICAN SWINE FEVER. https://www.woah.org/app/uploads/2021/03/african-swine-fever.pdf
Okwasiimire, R., Nassali, A., Ndoboli, D., Ekakoro, J. E., Faburay, B., Wampande, E., & Havas, K. A. (2023). Comparison of diaphragm meat juice and muscle swab samples to spleen and spleen swab samples for the detection of African swine fever viral nucleic acid. Journal of Veterinary Diagnostic Investigation, 35(2), 145–152.
Pandarangga, P. (2021). Molecular and Immunology Studies of Vaccinated Chickens with Newcastle Disease Virus Genotype II and Genotype VII. The University of Adelaide.
Pandarangga, P., Cahyono, M. I., McAllister, M. M., Peaston, A. E., Tearle, R., Low, W. Y., Doan, P. T. K., Rabiei, M., Ignjatovic, J., & Dharmayanti, N. P. I. (2020). Full-genome sequences of two Newcastle disease virus strains isolated in West Java, Indonesia. Microbiology Resource Announcements, 9(24), e00221-20.
Pandarangga, P., McAllister, M. M., Peaston, A. E., Ngai, Y. T., Cahyono, M. I., & Hemmatzadeh, F. (2022). Performance comparison of homologous and heterologous Newcastle disease virus in vaccines and antibody tests. Research in Veterinary Science, 149, 82–89.
Shi, K., Liu, H., Yin, Y., Si, H., Long, F., & Feng, S. (2022). Molecular characterization of African swine fever virus from 2019-2020 outbreaks in Guangxi Province, Southern China. Frontiers in Veterinary Science, 9.
Truong, A. D., Ly, D. V., Vu, T. H., Nguyen, T. C., Chu, T. N., Nguyen, H. T., Pham, N. T., Tran, H. T. T., & Dang, H. V. (2020). Unexpected cases in field diagnosis of African swine fever virus in Vietnam: The needs consideration when performing molecular diagnostic tests. Open Veterinary Journal, 10(2), 189–197.
Vika, D. (2021). Populasi Babi di NTT Terbanyak Nasional pada 2021. https://databoks.katadata.co.id/datapublish/2021/11/23/populasi-babi-di-ntt-terbanyak-nasional-pada-2021
Wahyuningsih, H., Cayami, F. K., Bahrudin, U., Sobirin, M. A., Mundhofir, F. E. P., Faradz, S. M. H., & Hisatome, I. (2017). Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance. Yonago Acta Medica, 60(1), 24.
Zhu, J. J., Ramanathan, P., Bishop, E. A., O’Donnell, V., Gladue, D. P., & Borca, M. V. (2019). Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages. PloS One, 14(11), e0223955.

PlumX Metrics

Published
2024-01-03
How to Cite
Pandarangga, P., Ticoalu, A., Gelolodo, M., & Toha, L. (2024). Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province. JURNAL KAJIAN VETERINER, 11(2), 218-224. https://doi.org/10.35508/jkv.v11i2.13118
Issue
Vol 11 No 2 (2023): Jurnal Kajian Veteriner
Section
Articles

Copyright (c) 2024 JURNAL KAJIAN VETERINER

Creative Commons License

This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Most read articles by the same author(s)

Obs.: This plugin requires at least one statistics/report plugin to be enabled. If your statistics plugins provide more than one metric then please also select a main metric on the admin's site settings page and/or on the journal manager's settings pages.