JURNAL KAJIAN VETERINER https://ejurnal.undana.ac.id/index.php/JKV <p><strong>ISSN:</strong> 2356-4113 (Printed)</p> <p><strong>e-ISSN:</strong> 2528-6021 (Online)</p> <p>DOI : <a href="https://ejurnal.undana.ac.id/jkv">https://doi.org/10.35508/jkv</a></p> <p>Jurnal Kajian Veteriner is a scientific journals was published since May, 2012. This journal used to be sharing information and communication about the result of research at Veterinary scope. Jurnal Kajian Veteriner publish twice a year at June and December. Based on decree of the Minister of Research and Technology/ National Research and Innovation Agency number&nbsp;200/M/KPT/2020 dated December 23th 2020, Jurnal Kajian Veteriner&nbsp;(ISSN: 2356-4113; E-ISSN: 2528-6021) has been accredited SINTA 4 since Volume 5 Issue 2 2018.</p> en-US detha.air@staf.undana.ac.id (Annytha Ina Rohi Detha) jurnalkajianveteriner@undana.ac.id (Margie Mila Meha) Mon, 11 Dec 2023 16:21:57 +0000 OJS 3.1.1.2 http://blogs.law.harvard.edu/tech/rss 60 Laporan Kasus : Feline Immunodeficiency Virus pada Kucing Moi di Surabaya https://ejurnal.undana.ac.id/index.php/JKV/article/view/12803 <p><em>Feline immunodeficiency (FIV) is a disease caused by retroviridae of the lentivirus genus and is dangerous for cats. This virus attacks the cat's immune system. FIV disease can be transmitted horizontally via as saliva and body fluids. 5-month-old black and white Persian cat named Moi, brought by the owner with complaints of vomiting yesterday, refusing to eat and drink, soft stool, no coughing and sneezing, weakness. On physical examination showed a temperature of 40.1 °C with a body weight of 1.5 kg, clinical symptoms were found in the form of gingivitis, canker sores, conjunctivitis, pale pink mucous membranes, fever, flu symptoms from the nose with clear discharge, crepitus in both ears. Diagnosis of Moi Cats based on anamnesis, physical examination, clinical symptoms, and supporting examinations is diagnosed with Feline immunodeficiency virus (FIV). Case are treated using a combination of antibiotics, anti-inflammatories, fluid therapy, antiemetics, gastrointestinal linings, immune boosters, blood boosters, and cardiac pacemakers. After 4 days the cat Moi was declared dead due to failure of platelet hemostasis, bleeding, and heart failure.</em></p> Ady Kurnianto, Maria Millenia ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/12803 Sat, 09 Dec 2023 12:54:47 +0000 Kuantifikasi Mikroorganisme dan Kelayakan Konsumsi Madu Lokal yang Diperjualbelikan di Kabupaten TTS (Timor Tengah Selatan) https://ejurnal.undana.ac.id/index.php/JKV/article/view/7557 <p><em><span lang="ZH-CN">Honey is a product of animal origin with a low water composition but rich in sugar content (fructose and glucose) which is produced through the fermentation process in honey bee hives. This study aims to look at the quantification of microorganisms and the physicochemical quality of local honey which is traded in TTS (South Central Timor) Regency. The testing technique was carried out using the TPC test for total bacterial contamination and total mold and yeast contamination, testing the physical properties of honey using heating and organoleptic testing, and testing the chemical properties of honey which included testing water content, sugar content and pH. The test was carried out on 8 honey samples taken from 3 honey-producing villages in TTS Regency, namely Loli Village, Tobaki Village, and Nenas Village. The results of the total bacteria, mold and yeast test showed that the average bacterial contamination in honey was 7.24×10<sup>5</sup> and the average mold and yeast contamination was 30.31×10<sup>5</sup>, where these results exceeded the contamination limit according to SNI</span> <span lang="IN">No.7388:2009</span><span lang="ZH-CN">, namely the total contamination. bacteria &lt;5×10<sup>3</sup> colonies/g and total mold and yeast contamination &lt;1×10<sup>1</sup> colony/g. The physico-chemical properties test was carried out to find that the physical properties of honey were not in accordance with the</span> <span lang="IN">SNI No.01-3545-2013 and SNI No.8664:2018.</span></em></p> Catharina De Ricci Inye Bero, Maxs U. E. Sanam, Diana A. Wuri ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/7557 Sun, 10 Dec 2023 16:40:17 +0000 Respon Vaksinasi ND Ayam IPB D1 yang Dipelihara pada Lingkungan Lahan Kering https://ejurnal.undana.ac.id/index.php/JKV/article/view/8249 <p><em>Newcastle Disease (ND) is one of the diseases that causes large losses in the poultry farming industry. Vaccination can reduce symptoms and protect chickens from ND. High maintenance temperatures on dry land can interfere with immune cell production. IPB D1 chicken is a chicken resulting from a cross between local chickens and purebred chickens that is resistant to disease. The aim of the research was to determine the response of IPB D1 chicken vaccination against Newcastle Disease (ND) and compare the antibody titers of IPB D1 chickens in tropical regions that were vaccinated with ND via the drinking water and intramuscular routes. This research was carried out on 30 IPB D1 chickens divided into three groups, namely , group A vaccination via drinking water, group B vaccination via intramuscular and control group (C) with the aim of comparing the antibody titers of IPB D1 chickens vaccinated via drinking water and intramuscularly and to determine the response of vaccination of IPB D1 chickens against Newcastle Disease. Pre- and post-vaccination immune responses were tested using hemagglutination inhibition (HI). The results showed that the group of chickens vaccinated through drinking water had an average pre-vaccination antibody titer of 1.8 ± 0.91 log 2, at week 2 post-vaccination it was 3.3 ± 2.05 log 2, at week 4 post-vaccination it was 5 .3 ± 2.31 log 2 and at the 8th week post-vaccination 3.2 ± 1.22 log 2. The average antibody titer in the group of chickens vaccinated via intramuscular pre-vaccination was 1.6 ± 0.51 log 2, at week 2. -2 post-vaccination 5.4 ± 3.09 log 2, at the 4th week post-vaccination 4.89 ± 2.71 log 2 and at the 8th week post-vaccination 3.56 ± 2.01. It was concluded that ND vaccination via the drinking water and intramuscular route was able to increase antibodies to reach an average titer above 4 HI log 2 within a period of at least four weeks after administering the vaccine to IPB D1 chickens kept in a dry land environment. The antibody titer of IPB D1 chickens vaccinated intramuscularly increased faster than those vaccinated through drinking water.</em></p> Graziela Angelicha Mandala, Elisabet Tangkonda, Maxs U. E. Sanam ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/8249 Sun, 10 Dec 2023 17:41:59 +0000 Evaluasi Efektivitas Antibiotik Komersil Terhadap Agen Penyebab Gejala Snot pada Ayam Broiler di Kabupaten Kupang https://ejurnal.undana.ac.id/index.php/JKV/article/view/13075 <p><em>Snot is a symptom of upper respiratory system infections in poultry, characterized by exudate production from the nasal cavity, swelling of infraorbital sinuses, snoring, sneezing, and dyspnoea.&nbsp; The aetiology of snot that have been isolated are Avibaterium paragallinarum, Pasteurella multocida, Ornithobacterium rhinotracheale, and Mycoplasma sp. Snot symptom can be eradicated with antibiotic treatment; however, antibiotic resistance makes antibiotic treatment ineffective. This study is aimed to evaluate the effectiveness of some commercial antibiotics against bacteria isolated from broiler chicken with snot symptom in Kupang Regency. Amoxycillin, ampicillin, tetracycline, cefoxitin, and ciprofloxacin were tested using the Kirby Bauer method with McFarland Turbidity Standard against Avibacterium paragallinarum, Ornithobacterium rhinotracheale, Pasteurella multocida, and Mycoplasma sp isolates. Inhibition zones were measured and compared to the standard of the Clinical Laboratory Standard Institute (CLSI) to determine the sensitivity or resistance percentage. The result showed that Avibacterium paragallinarum, Ornithobacterium rhinotracheale, Pasteurella multocida, and Mycoplasma sp were highly resistant to amoxycillin and ampicillin, yet most sensitif to ciprofloxacin. This suggests commercial antibiotics that are productive to eradicate snot symptom and implies some antibiotics that are ineffective to overcome snot symptom and hence should not be used in the field.</em></p> Bergitha Soge, Elisabet Tangkonda, Antin Y. N. Widi, Maxs U. E. Sanam, Herlina Umbu Deta ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/13075 Mon, 11 Dec 2023 09:55:09 +0000 Studi Kasus: Urolithiasis Pada Kucing Mezza di Surabaya https://ejurnal.undana.ac.id/index.php/JKV/article/view/8190 <p><em>The most common disease of the lower urinary tract in cats is FLUTD. FLUTD (Feline lower urinary tract disease) is asyndrome that affects the reproductive tract, bladder or urethra. A cat named Mezza weighing 3.85 kg, 2.5 years old,was brought to the K and P Surabaya clinic on May 18 2022 with complaints of not being able to urinate for two days,not wanting to eat, drinking little, physically weak when brought . The results of the palpation examination of the catMezza showed that the urinary bladder was large, round in shape, and the cat was in pain when palpating, the resultsof a microscope examination of the urine sample found the presence of oxalate crystals. On physical examination thecat's body temperature was 38.5 °C, its physical condition looked active, slightly dehydrated but did not appear pale.Based on the anamnesis, physical examination and supporting examinations, it can be concluded that the Mezza cat isinfected with Urolithiasis and the prognosis is fausta. Ringer's lactate solution was chosen as fluid therapy. The injectiontherapy given is enrofloxacin and dexamethasone. Oral drugs given include fibumin, cystaid and Nutriplus gel. After thefourth day of therapy, the case cat whose urine was initially red had changed to a normal yellow color, and it wasobserved that until the fifth day, Mezza's cat's urination began to flow smoothly.</em></p> Mery Astuti, Intan Permatasari Hermawan ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/8190 Mon, 11 Dec 2023 16:21:33 +0000 Tinjauan Vibrio Vulnificus sebagai Ancaman Emerging Foodborne Disease pada Makanan Laut Segar https://ejurnal.undana.ac.id/index.php/JKV/article/view/12259 <p><em>Vibrio vulnificus is a crucial <a name="_Hlk141963551"></a>foodborne opportunistic pathogen that can cause <a name="_Hlk141963686"></a>wound infections<span lang="IN">, </span><a name="_Hlk141963671"></a>septicemia, and <a name="_Hlk141963736"></a>gastroenteritis<span lang="IN"> with a 50% fatality rate</span>. <span lang="IN">This bacteria</span> <span lang="IN">occurs </span>in estuaries and coastal waters and is found in large quantities in oysters and other mollusc shells. <span lang="IN">The increasing number of foodborne diseases worldwide is suspected to have occurred due to the expansion of the international food trade. Consumption of raw seafood, especially oysters containing Vibrio vulnificus bacteria, can result in acute, severe systemic infections and is responsible for 95% of deaths from seafood consumption in the United States.</span> <span lang="EN-US">The diagnosis of Vibrio vulnificus infection is confirmed by the growth of </span><span lang="IN">the bacteria</span><span lang="EN-US"> in culture</span><span lang="IN"> media</span><span lang="EN-US"> from wounds, feces or blood</span>. This article discusses the characteristics of the bacteria, host, environment, transmission, pathogenesis, clinical symptoms, diagnostic techniques and geographical distribution of V. vulnificus.</em></p> Maxs U. E. Sanam, Maria Aega Gelolodo, Elisabet Tangkonda, Fhady R. Loe ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/12259 Mon, 11 Dec 2023 17:28:23 +0000 Determination Shelf Life of Sun-Dried Pork Jerky using the Accelerated Shelf-Life Test Method (Case Study in Debali MSMEs, Kupang City) https://ejurnal.undana.ac.id/index.php/JKV/article/view/12897 <p>Kemasan dendeng yang diproduksi oleh UMKM jarang sekali disertai tanggal kadaluwarsanya. Penentuan umur simpan produk pangan seperti dendeng perlu dilakukan untuk menjamin keamanan pangan. Tujuan dari penelitian ini adalah untuk mengetahui umur simpan dendeng babi yang dijemur produksi Debali dengan menggunakan metode Accelerated Shelf-Life Testing berdasarkan persamaan Arrhenius. Dendeng babi yang dijemur yang diproduksi oleh UMKM Debali di Kota Kupang digunakan dalam penelitian ini. Dendeng babi disimpan dalam inkubator selama 30 hari pada tiga suhu yaitu 25 °C, 35 °C, dan 45 °C. Setiap lima hari dilakukan pengujian kualitas organoleptik seperti warna, rasa, bau, tekstur, dan daya terima. Uji organoleptik diikuti 7 panelis. Dengan menggunakan metode ASLT, lama penyimpanan dendeng adalah 30 hari pada suhu 25 °C, 29 hari pada suhu 35 °C, dan 28 hari pada suhu 45 °C. Kesimpulannya, dendeng babi yang dijemur produksi Debali mampu bertahan di suhu ruangan maksimal 30 hari.</p> Larry Richard Wellem Toha, Meity Marviana Laut, Lukista Christine Kana ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/12897 Tue, 12 Dec 2023 06:13:13 +0000 Pengaruh Sari Buah Naga Merah (Hylocereus polyrhizus) Terhadap Daya Tahan Hidup Spermatozoa Babi https://ejurnal.undana.ac.id/index.php/JKV/article/view/13014 <p>The aim of study was to determine the effect of the red dragon fruit juice (<em>Hylocereus polyrhizus</em>) on the viability of boar spermatozoa. The semen was contained from a healthy two year old male, using dummy sow's help. Good quality cement is divided into 5 groups where red dragon juice is added; 100 L (P1); 200 L (P2); 300 L (P3); 400 L (P4); 500 L (P5) deep in natural dilution and stored at prescribed temperatures. Spermatozoa's life observations were performed daily for every two hours of observation. A descriptive analysis of macroscopic and microscopic semen is obtained. The liquid semen evaluation data is analyzed using Analysis Of Variance (ANOVA). If there is a real difference in treatment, then a follow up test with Duncan to compare the results to each treatment. This study indicates that the real addition of coconut water thinkers and antioxidants of red dragon fruit (P&lt;0,05) to the durability of boar spermatozoa. Treatment by applying the 200µL/mL of red dragon fruit (<em>Hylocereus polyrhizus</em>) to the treatment of the rhizus fruit (<em>Hylocereus polyrhizus</em>) to the treatment of the semen was effective in sustaining the viability of spermatozoa was shown by its 50,96% motility value with a 20 hour deposit.</p> Sherlina Victoria Seran, Nancy D. F. K. Foeh, Nemay A. Ndaong ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/13014 Tue, 12 Dec 2023 09:43:42 +0000 Uji Daya Koksidiostat Ekstrak Temulawak (Curcuma xanthorrhiza) Asal Pulau Timor pada Ayam Buras https://ejurnal.undana.ac.id/index.php/JKV/article/view/8237 <p><em>The development of livestock business in Indonesia has very profitable business prospects because the demand for animal products continues to grow. One of the livestock sub-sectors that are most in demand is poultry farming, especially free-range chicken. However, the development of poultry farming does not escape the obstacles faced by farmers, namely diseases, coccidiosis is one of them, which is a gastrointestinal protozoan infection caused by Eimeria spp. Coccidiosis management currently uses a coccidiostat, one of which is sulfaquinoxalin. However, sulfaquinoxalin has the disadvantage that it can cause a decrease in eggshell thickness and a decrease in feed consumption. The aim of this research is to find alternatives for the prevention and treatment of Eimeria tenella infection. This study used extracts of temulawak (Curcuma xanthorrhiza) from Timor Island. This study aims to know whether temulawak (Curcuma xanthorrhiza) extract from Timor Island is effective in treating coccidiosis and at what concentration is the most effective. The research methods included the manufacture of temulawak extract, experimental infection, collection of faecal samples, effectiveness testing and macroscopic observation of the cecum from chickens and calculating the score of the cecum lesions. This study used 3 treatment groups with 1 control. The treatment group used graded doses of temulawak (Curcuma xanthorrhiza) extract namely 0.2%, 0.4% and 0.6%, while the positive control used Coxy (©Medion) at a dose of 5 grams per liter of drinking water. The results showed that the temulawak extract (Curcuma xanthorrhiza) from the island of Timor was effective in inhibiting the growth of Eimeria tenella in vivo, with the most effective concentration of 0.2%.</em></p> Oktav F. W. Kurniawan, Meity M. Laut, Aji Winarso ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/8237 Sun, 17 Dec 2023 14:55:25 +0000 The Pakan Fermentasi Berbasis Bahan Lokal Berbentuk Pellet dan Tepung Terhadap Performa, Karkas dan Organ Intestinal Ayam Broiler https://ejurnal.undana.ac.id/index.php/JKV/article/view/12596 <p><em>This study aims to examine the fermentation method on local feed in the form of mash and pellets on the performance, carcass and intestinal organs of broiler chickens. The livestock used were 144 CP 707 broiler chickens aged 21 days. The study used a completely randomized design with a 3x2 factorial pattern, namely 3 fermented feed treatments (F0 = non-fermented, F1 = fermented with Effective Microorganisms-4 (EM4), and F2 = Local Microorganism (MOL) fermented), and 2 forms of feed (B1 = mash, B2 = Pellet), so there were 6 treatment. Each treatment was repeated 6 times and each repetition consisted of 4 chickens. Parameters measured were the performance of broiler chickens, carcasses and intestinal organs. Data were analysed by ANOVA test and continued with Duncan's test. The results showed that feeding fermented Effective Microorganisms-4 (EM4) and Local Microorganism (MOL) had a significant effect on chicken performance and final weight (P&lt;0.01), but no significant effect on carcass weight and percentage (P&gt;0.05). As for the intestinal organs, feeding fermented Effective Microorganisms-4 (EM4) and Local Microorganism (MOL) had no significant effect on the percentage of liver, ventricle, proventriculus and small intestine (P&gt;0.05) and had a significant effect on the length of the small intestine (P&lt;0.01).</em></p> Kurnia Riwu Manu, N. G. A. Mulyantini, Novalino H. G. Kallau, Franky M. S. Telupere, Annytha I. R. Detha ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/12596 Tue, 19 Dec 2023 23:20:17 +0000 Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province https://ejurnal.undana.ac.id/index.php/JKV/article/view/13118 <p><em>African Swine Fever</em> (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan <em>false negatives</em> pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : <em>5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer)</em> dan <em>5' GCCGATACCACAAGATCAGC 3' (reverse primer)</em> dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.</p> Putri Pandarangga, Abigail E. Ticoalu, Maria A. E. G. A Gelolodo, Larry R. W. Toha ##submission.copyrightStatement## http://creativecommons.org/licenses/by-nc-nd/4.0 https://ejurnal.undana.ac.id/index.php/JKV/article/view/13118 Wed, 03 Jan 2024 07:48:31 +0000